You put a lot of identical DNA strands in a sequencer and use an algorithm that identifies overlaps and restores the strand sequence.
Toy example: if you have reads “GCTTTAGCCCCTAGG” and “TAGCCCCTAGGAATCC”, there is propably “GCTTTAGCCCCTAGGAATCC” in the original DNA. Of course, real reads and overlaps are usually much longer.
(Epistemic status: studied bioinformatics for 1 year, in 2016-2017, forgot a lot)
>how do you build a complete picture of a genome
You put a lot of identical DNA strands in a sequencer and use an algorithm that identifies overlaps and restores the strand sequence.
Toy example: if you have reads “GCTTTAGCCCCTAGG” and “TAGCCCCTAGGAATCC”, there is propably “GCTTTAGCCCCTAGGAATCC” in the original DNA. Of course, real reads and overlaps are usually much longer.
(Epistemic status: studied bioinformatics for 1 year, in 2016-2017, forgot a lot)